Transcript: Human XM_005256860.2

PREDICTED: Homo sapiens sperm antigen with calponin homology and coiled-coil domains 1 (SPECC1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPECC1 (92521)
Length:
6548
CDS:
361..1587

Additional Resources:

NCBI RefSeq record:
XM_005256860.2
NBCI Gene record:
SPECC1 (92521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 4902 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
2 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5001 3UTR 100% 4.950 2.475 Y LOC387873 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4149 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141125 CAGGTTCAAGAGATTCTCCTA pLKO.1 4875 3UTR 100% 2.640 1.320 Y SYNE4 n/a
5 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 4237 3UTR 100% 0.495 0.248 Y C11orf44 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4149 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.