Transcript: Human XM_005257277.3

PREDICTED: Homo sapiens homeobox B3 (HOXB3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HOXB3 (3213)
Length:
3332
CDS:
573..1868

Additional Resources:

NCBI RefSeq record:
XM_005257277.3
NBCI Gene record:
HOXB3 (3213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257277.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015647 GAATCCAAGAAGCGCCCAAAT pLKO.1 1834 CDS 100% 10.800 15.120 N HOXB3 n/a
2 TRCN0000434090 GAAAGGGCGAACGAGGATTAG pLKO_005 1872 3UTR 100% 10.800 8.640 N HOXB3 n/a
3 TRCN0000070845 CACCCTCACCAAACAGATATT pLKO.1 941 CDS 100% 13.200 9.240 N Hoxb3 n/a
4 TRCN0000421612 CTTACATCTTTGTAGGTAATT pLKO_005 2256 3UTR 100% 13.200 9.240 N HOXB3 n/a
5 TRCN0000015644 GCCACTAGCAACAGCAGTAAT pLKO.1 867 CDS 100% 13.200 9.240 N HOXB3 n/a
6 TRCN0000422513 ACACGTTCCCTTCCAACTTTC pLKO_005 2358 3UTR 100% 10.800 7.560 N HOXB3 n/a
7 TRCN0000015643 CGGAAAGGAATCCACATCATA pLKO.1 2079 3UTR 100% 5.625 3.938 N HOXB3 n/a
8 TRCN0000433739 CATCACCAACCAACGGACTTA pLKO_005 2234 3UTR 100% 4.950 3.465 N HOXB3 n/a
9 TRCN0000015645 GCCGGCTTCATGAACGCCTTA pLKO.1 1389 CDS 100% 1.350 0.945 N HOXB3 n/a
10 TRCN0000015646 GCTGCTCTCTTCGGAGGCTAT pLKO.1 606 CDS 100% 1.350 0.945 N HOXB3 n/a
11 TRCN0000413805 ACCCTCACCAAACAGATATTC pLKO_005 942 CDS 100% 13.200 7.920 N HOXB3 n/a
12 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 1265 CDS 100% 4.050 2.025 Y Hoxa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257277.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.