Transcript: Human XM_005257311.4

PREDICTED: Homo sapiens integrin subunit beta 4 (ITGB4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGB4 (3691)
Length:
6176
CDS:
285..5912

Additional Resources:

NCBI RefSeq record:
XM_005257311.4
NBCI Gene record:
ITGB4 (3691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257311.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296114 ACGATGACAACCGACCTATTG pLKO_005 4066 CDS 100% 10.800 15.120 N ITGB4 n/a
2 TRCN0000308077 TGTACCCGTATTGCGACTATG pLKO_005 3841 CDS 100% 10.800 15.120 N ITGB4 n/a
3 TRCN0000057770 CCAGCGACTACACTATTGGAT pLKO.1 775 CDS 100% 3.000 4.200 N ITGB4 n/a
4 TRCN0000057772 CGAGGTCACATGGTGGGCTTT pLKO.1 2535 CDS 100% 1.350 1.890 N ITGB4 n/a
5 TRCN0000296113 GTGGATGAGTTCCGGAATAAA pLKO_005 921 CDS 100% 15.000 12.000 N ITGB4 n/a
6 TRCN0000296112 GAGAAGCTTCACACCTATTTC pLKO_005 1284 CDS 100% 13.200 9.240 N ITGB4 n/a
7 TRCN0000057771 GAGGGTGTCATCACCATTGAA pLKO.1 5280 CDS 100% 5.625 3.938 N ITGB4 n/a
8 TRCN0000306738 GAGGGTGTCATCACCATTGAA pLKO_005 5280 CDS 100% 5.625 3.938 N ITGB4 n/a
9 TRCN0000057768 CTCCTCAGCTACTCCATCCTT pLKO.1 5975 3UTR 100% 3.000 2.100 N ITGB4 n/a
10 TRCN0000057769 CCCATGAAGAAAGTGCTGGTT pLKO.1 4089 CDS 100% 2.640 1.584 N ITGB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257311.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.