Transcript: Human XM_005257572.4

PREDICTED: Homo sapiens xylosyltransferase 2 (XYLT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XYLT2 (64132)
Length:
3351
CDS:
520..3021

Additional Resources:

NCBI RefSeq record:
XM_005257572.4
NBCI Gene record:
XYLT2 (64132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437338 CCTTGACCTTCAACCGCAAAC pLKO_005 2663 CDS 100% 6.000 8.400 N XYLT2 n/a
2 TRCN0000438179 GACCCGGGAAATTGCACCTTA pLKO_005 3048 3UTR 100% 4.950 6.930 N XYLT2 n/a
3 TRCN0000034916 CTGTATTTCTATGACGACCAT pLKO.1 2203 CDS 100% 2.640 3.696 N XYLT2 n/a
4 TRCN0000444742 TTCCCACCACACGGAGATACA pLKO_005 835 CDS 100% 4.950 3.960 N XYLT2 n/a
5 TRCN0000034915 CCGGGACAACTCCAGGTTCAT pLKO.1 1497 CDS 100% 1.650 1.320 N XYLT2 n/a
6 TRCN0000034917 CGTCTCCTCAAGGCCGTTTAT pLKO.1 1171 CDS 100% 13.200 9.240 N XYLT2 n/a
7 TRCN0000443329 GGAGACTGAGGTCACGCAATA pLKO_005 2544 CDS 100% 10.800 7.560 N XYLT2 n/a
8 TRCN0000034914 CGAGTACATGGAGCAGAGTTT pLKO.1 2736 CDS 100% 4.950 3.465 N XYLT2 n/a
9 TRCN0000034918 GCCACATCTTATGACATCACA pLKO.1 2515 CDS 100% 3.000 2.100 N XYLT2 n/a
10 TRCN0000438746 ACCTCAGTGCCACTGACTATC pLKO_005 1403 CDS 100% 10.800 6.480 N XYLT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.