Transcript: Human XM_005257787.4

PREDICTED: Homo sapiens tripartite motif containing 47 (TRIM47), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM47 (91107)
Length:
2310
CDS:
789..1991

Additional Resources:

NCBI RefSeq record:
XM_005257787.4
NBCI Gene record:
TRIM47 (91107)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295947 TACTGGGAGGTGGAGATTATC pLKO_005 1521 CDS 100% 13.200 9.240 N TRIM47 n/a
2 TRCN0000310175 TGAAGCTCCCAGGGACTATTT pLKO_005 1322 CDS 100% 13.200 9.240 N TRIM47 n/a
3 TRCN0000034050 GTTTGCCTATATTGTGGATTT pLKO.1 1349 CDS 100% 10.800 7.560 N TRIM47 n/a
4 TRCN0000034052 CACCAAATCATCCCAAGCTGT pLKO.1 1151 CDS 100% 2.640 1.848 N TRIM47 n/a
5 TRCN0000034051 GCAGTGGAATGGACGCAGCTT pLKO.1 1640 CDS 100% 0.880 0.616 N TRIM47 n/a
6 TRCN0000034053 CAAGAAGTCCTGCATATCCGT pLKO.1 1955 CDS 100% 0.750 0.525 N TRIM47 n/a
7 TRCN0000298789 CAAGAAGTCCTGCATATCCGT pLKO_005 1955 CDS 100% 0.750 0.525 N TRIM47 n/a
8 TRCN0000310174 GAGGGTGCTGTGTCCTATCAA pLKO_005 1424 CDS 100% 5.625 3.375 N TRIM47 n/a
9 TRCN0000034049 CCACACACCCAGCCTTCTCAT pLKO.1 2085 3UTR 100% 1.650 0.990 N TRIM47 n/a
10 TRCN0000298790 CCACACACCCAGCCTTCTCAT pLKO_005 2085 3UTR 100% 1.650 0.990 N TRIM47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.