Transcript: Human XM_005257788.5

PREDICTED: Homo sapiens tripartite motif containing 47 (TRIM47), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM47 (91107)
Length:
1670
CDS:
149..1351

Additional Resources:

NCBI RefSeq record:
XM_005257788.5
NBCI Gene record:
TRIM47 (91107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257788.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295947 TACTGGGAGGTGGAGATTATC pLKO_005 881 CDS 100% 13.200 9.240 N TRIM47 n/a
2 TRCN0000310175 TGAAGCTCCCAGGGACTATTT pLKO_005 682 CDS 100% 13.200 9.240 N TRIM47 n/a
3 TRCN0000034050 GTTTGCCTATATTGTGGATTT pLKO.1 709 CDS 100% 10.800 7.560 N TRIM47 n/a
4 TRCN0000034052 CACCAAATCATCCCAAGCTGT pLKO.1 511 CDS 100% 2.640 1.848 N TRIM47 n/a
5 TRCN0000034051 GCAGTGGAATGGACGCAGCTT pLKO.1 1000 CDS 100% 0.880 0.616 N TRIM47 n/a
6 TRCN0000034053 CAAGAAGTCCTGCATATCCGT pLKO.1 1315 CDS 100% 0.750 0.525 N TRIM47 n/a
7 TRCN0000298789 CAAGAAGTCCTGCATATCCGT pLKO_005 1315 CDS 100% 0.750 0.525 N TRIM47 n/a
8 TRCN0000310174 GAGGGTGCTGTGTCCTATCAA pLKO_005 784 CDS 100% 5.625 3.375 N TRIM47 n/a
9 TRCN0000034049 CCACACACCCAGCCTTCTCAT pLKO.1 1445 3UTR 100% 1.650 0.990 N TRIM47 n/a
10 TRCN0000298790 CCACACACCCAGCCTTCTCAT pLKO_005 1445 3UTR 100% 1.650 0.990 N TRIM47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257788.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.