Transcript: Human XM_005257859.4

PREDICTED: Homo sapiens TBK1 binding protein 1 (TBKBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBKBP1 (9755)
Length:
3428
CDS:
149..1996

Additional Resources:

NCBI RefSeq record:
XM_005257859.4
NBCI Gene record:
TBKBP1 (9755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257859.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148724 CCTCAAAGTCTACGAGATCAA pLKO.1 352 CDS 100% 4.950 6.930 N TBKBP1 n/a
2 TRCN0000129301 CAGAAGAACAAGGAGCAGGAA pLKO.1 500 CDS 100% 2.640 3.696 N TBKBP1 n/a
3 TRCN0000130218 CCTCTGCCTTTCTGTTCTTAA pLKO.1 2281 3UTR 100% 13.200 7.920 N TBKBP1 n/a
4 TRCN0000129060 GCTGTGGAGATCAACTTCAAA pLKO.1 2938 3UTR 100% 5.625 3.375 N TBKBP1 n/a
5 TRCN0000128994 GAGAATCTTGAGGACTCTGTT pLKO.1 1096 CDS 100% 4.950 2.970 N TBKBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257859.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.