Transcript: Human XM_005258945.1

PREDICTED: Homo sapiens LDL receptor related protein 3 (LRP3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRP3 (4037)
Length:
3657
CDS:
11..2368

Additional Resources:

NCBI RefSeq record:
XM_005258945.1
NBCI Gene record:
LRP3 (4037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310727 GCGACCGTGGTGACATGATTA pLKO_005 243 CDS 100% 13.200 18.480 N LRP3 n/a
2 TRCN0000303578 TCTCATCCGTGGTGACTATTT pLKO_005 2764 3UTR 100% 13.200 18.480 N LRP3 n/a
3 TRCN0000060822 TGACGACTACGTGCAGGTATA pLKO.1 922 CDS 100% 10.800 15.120 N LRP3 n/a
4 TRCN0000315785 TGACGACTACGTGCAGGTATA pLKO_005 922 CDS 100% 10.800 15.120 N LRP3 n/a
5 TRCN0000060820 CGTGGAGGACTTTCCTGTCTA pLKO.1 1747 CDS 100% 4.950 3.465 N LRP3 n/a
6 TRCN0000315865 CGTGGAGGACTTTCCTGTCTA pLKO_005 1747 CDS 100% 4.950 3.465 N LRP3 n/a
7 TRCN0000060819 TCTGTCTTACATCCGAGGGAA pLKO.1 469 CDS 100% 2.640 1.848 N LRP3 n/a
8 TRCN0000060821 GCCCGTGGACAAGGACAGAAA pLKO.1 2137 CDS 100% 1.650 1.155 N LRP3 n/a
9 TRCN0000315784 GCCCGTGGACAAGGACAGAAA pLKO_005 2137 CDS 100% 1.650 1.155 N LRP3 n/a
10 TRCN0000254603 CCAACTGCAGCTGGTACATTC pLKO_005 219 CDS 100% 10.800 7.560 N Lrp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.