Transcript: Human XM_005259057.3

PREDICTED: Homo sapiens SMG9 nonsense mediated mRNA decay factor (SMG9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMG9 (56006)
Length:
2857
CDS:
316..1881

Additional Resources:

NCBI RefSeq record:
XM_005259057.3
NBCI Gene record:
SMG9 (56006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439407 CGATGAAGGCACCGAGTACTA pLKO_005 1386 CDS 100% 4.950 6.930 N SMG9 n/a
2 TRCN0000061852 CATGTTACAATGCAATGTCTT pLKO.1 1536 CDS 100% 4.950 3.465 N SMG9 n/a
3 TRCN0000061848 CCTAGTCTTCTTGCAGAACAA pLKO.1 1413 CDS 100% 4.950 3.465 N SMG9 n/a
4 TRCN0000061849 CTCATCAATAATGACCGCAAA pLKO.1 1159 CDS 100% 4.050 2.835 N SMG9 n/a
5 TRCN0000061851 GTACCCTTCATGGACAGTGAA pLKO.1 1606 CDS 100% 0.000 0.000 N SMG9 n/a
6 TRCN0000281647 CACAGCCTGTGTACCAGATTC pLKO_005 743 CDS 100% 10.800 7.560 N Smg9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.