Transcript: Human XM_005259267.4

PREDICTED: Homo sapiens zinc finger protein 552 (ZNF552), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF552 (79818)
Length:
3606
CDS:
1437..2648

Additional Resources:

NCBI RefSeq record:
XM_005259267.4
NBCI Gene record:
ZNF552 (79818)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259267.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422833 AGTGAGTCCAGTCTCATTAAA pLKO_005 2653 3UTR 100% 15.000 10.500 N ZNF552 n/a
2 TRCN0000015341 GTGTGAGGTTTGTCAGAAATT pLKO.1 2315 CDS 100% 13.200 7.920 N ZNF552 n/a
3 TRCN0000015339 GCTCTACATTCCGTGTTCATA pLKO.1 2431 CDS 100% 5.625 3.375 N ZNF552 n/a
4 TRCN0000015340 CCTTCTAAGCAGAGTATTTAT pLKO.1 1617 CDS 100% 15.000 7.500 Y ZNF552 n/a
5 TRCN0000015342 CAGCACCAGAATGAGCACATT pLKO.1 1830 CDS 100% 4.950 2.475 Y ZNF552 n/a
6 TRCN0000015338 GCAGATCATCAGGGAACACAT pLKO.1 1743 CDS 100% 4.950 2.475 Y ZNF552 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259267.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.