Transcript: Human XM_005259999.2

PREDICTED: Homo sapiens solute carrier family 44 member 2 (SLC44A2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC44A2 (57153)
Length:
2843
CDS:
77..2206

Additional Resources:

NCBI RefSeq record:
XM_005259999.2
NBCI Gene record:
SLC44A2 (57153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154638 CCGTCTCTTGGTACTGGATTA pLKO.1 756 CDS 100% 10.800 15.120 N SLC44A2 n/a
2 TRCN0000152143 CCTGGCTTCAAGAACAATAAA pLKO.1 491 CDS 100% 15.000 10.500 N SLC44A2 n/a
3 TRCN0000152114 CGGAATATTTCACTGCTACAT pLKO.1 892 CDS 100% 4.950 3.465 N SLC44A2 n/a
4 TRCN0000151652 CTGAGTATCCTTGAAGTCATT pLKO.1 1034 CDS 100% 4.950 3.465 N SLC44A2 n/a
5 TRCN0000154861 GTGCAGATCATCCGTGTGATA pLKO.1 1613 CDS 100% 4.950 3.465 N SLC44A2 n/a
6 TRCN0000156049 CTTCATGTCTTCCACCCTCAA pLKO.1 2253 3UTR 100% 4.050 2.835 N SLC44A2 n/a
7 TRCN0000156146 CCTACTTGATTGCACACGGTT pLKO.1 2016 CDS 100% 2.640 1.848 N SLC44A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.