Transcript: Human XM_005260195.4

PREDICTED: Homo sapiens zinc finger and BTB domain containing 46 (ZBTB46), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB46 (140685)
Length:
5311
CDS:
282..2051

Additional Resources:

NCBI RefSeq record:
XM_005260195.4
NBCI Gene record:
ZBTB46 (140685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260195.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156585 GCTACTTCAAGACGCTCTACT pLKO.1 442 CDS 100% 4.950 6.930 N ZBTB46 n/a
2 TRCN0000158196 CAAGGCCATCATCGACTTCAT pLKO.1 530 CDS 100% 4.950 3.465 N ZBTB46 n/a
3 TRCN0000157893 CGGTGCAGTACAGAACTCTTT pLKO.1 1025 CDS 100% 4.950 3.465 N ZBTB46 n/a
4 TRCN0000157843 CCTGAATGAGTTCACGGTGAT pLKO.1 1502 CDS 100% 4.050 2.835 N ZBTB46 n/a
5 TRCN0000152836 GATGTTTCTTCACAGCCTCTA pLKO.1 909 CDS 100% 4.050 2.835 N ZBTB46 n/a
6 TRCN0000152567 GAAGAAGTTCAAGTGTCCGTA pLKO.1 1526 CDS 100% 2.640 1.848 N ZBTB46 n/a
7 TRCN0000156660 GCTCATGAGTAAGAACAGCCT pLKO.1 1400 CDS 100% 0.660 0.462 N ZBTB46 n/a
8 TRCN0000158031 CCACAGCAAGGACAAGAAGTA pLKO.1 1682 CDS 100% 4.950 2.970 N ZBTB46 n/a
9 TRCN0000158410 CGTGGCAGATTTCCTGTTCTT pLKO.1 4271 3UTR 100% 4.950 2.970 N ZBTB46 n/a
10 TRCN0000153223 GCATTTGGAAACCAGACCTTT pLKO.1 4021 3UTR 100% 4.950 2.970 N ZBTB46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260195.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.