Transcript: Human XM_005260252.3

PREDICTED: Homo sapiens ADP ribosylation factor guanine nucleotide exchange factor 2 (ARFGEF2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARFGEF2 (10564)
Length:
8330
CDS:
170..5524

Additional Resources:

NCBI RefSeq record:
XM_005260252.3
NBCI Gene record:
ARFGEF2 (10564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251882 CATTGAAGCTGACAAGTATTT pLKO_005 355 CDS 100% 13.200 9.240 N Arfgef2 n/a
2 TRCN0000047315 CGACACCATTAAGACGCTTAT pLKO.1 3070 CDS 100% 10.800 7.560 N ARFGEF2 n/a
3 TRCN0000047314 CGCCAGTCTTTAAGCAGCATA pLKO.1 4691 CDS 100% 4.950 3.465 N ARFGEF2 n/a
4 TRCN0000047317 CCCTGAGCAATTTGAGGTCAT pLKO.1 2065 CDS 100% 4.050 2.835 N ARFGEF2 n/a
5 TRCN0000047313 GCTTCATTTCTATCATTCCAT pLKO.1 5750 3UTR 100% 3.000 2.100 N ARFGEF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.