Transcript: Human XM_005260288.2

PREDICTED: Homo sapiens nucleolar protein 4 like (NOL4L), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOL4L (140688)
Length:
1613
CDS:
303..1613

Additional Resources:

NCBI RefSeq record:
XM_005260288.2
NBCI Gene record:
NOL4L (140688)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369587 AGCGGATGCGTCTAGAGATCT pLKO_005 1156 CDS 100% 4.950 6.930 N NOL4L n/a
2 TRCN0000369646 ACAGCTCTGGGAGCTACGATT pLKO_005 700 CDS 100% 4.950 3.960 N NOL4L n/a
3 TRCN0000263572 CATGGACCCTGAGCGTCTTAA pLKO_005 845 CDS 100% 13.200 9.240 N NOL4L n/a
4 TRCN0000263569 ACGATGACCATGAGGACAATG pLKO_005 802 CDS 100% 10.800 7.560 N NOL4L n/a
5 TRCN0000263571 CAACATGTTTGTGCGTCTCTT pLKO_005 872 CDS 100% 4.950 3.465 N NOL4L n/a
6 TRCN0000172711 GATGAACGACTCTGAAGGCAT pLKO.1 827 CDS 100% 2.640 1.848 N NOL4L n/a
7 TRCN0000172844 GTCTAGAGATCTACCAGTCCT pLKO.1 1165 CDS 100% 2.640 1.848 N NOL4L n/a
8 TRCN0000263568 TGTGAGAGCGAGACAAGAAAG pLKO_005 1128 CDS 100% 10.800 6.480 N NOL4L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.