Transcript: Human XM_005260436.3

PREDICTED: Homo sapiens PLAG1 like zinc finger 2 (PLAGL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLAGL2 (5326)
Length:
6010
CDS:
574..2064

Additional Resources:

NCBI RefSeq record:
XM_005260436.3
NBCI Gene record:
PLAGL2 (5326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434405 CCGTAGGACTTCAGGTATTAT pLKO_005 2281 3UTR 100% 15.000 21.000 N PLAGL2 n/a
2 TRCN0000417239 TTCAGGCTCTAGGATCGATTC pLKO_005 2218 3UTR 100% 6.000 8.400 N PLAGL2 n/a
3 TRCN0000220188 CGGTTCTATACTCGTAAGGAT pLKO.1 1168 CDS 100% 3.000 4.200 N PLAGL2 n/a
4 TRCN0000220189 GCTTCCAAATACAAGCTGTAT pLKO.1 811 CDS 100% 4.950 3.960 N PLAGL2 n/a
5 TRCN0000430405 GCAGGAGAGAAGGCCTTTATT pLKO_005 2554 3UTR 100% 15.000 10.500 N PLAGL2 n/a
6 TRCN0000416757 TTGGATGACCTCTAGAGAAAT pLKO_005 2423 3UTR 100% 13.200 9.240 N PLAGL2 n/a
7 TRCN0000436685 AGACCCATGATCCTAACAAAG pLKO_005 926 CDS 100% 10.800 7.560 N PLAGL2 n/a
8 TRCN0000220185 GCCTGGTTGTTCAAAGGATAA pLKO.1 4758 3UTR 100% 10.800 7.560 N PLAGL2 n/a
9 TRCN0000427467 TGTACTGTGATAAGATGTTTC pLKO_005 875 CDS 100% 10.800 7.560 N PLAGL2 n/a
10 TRCN0000423609 CCTCGTTTCCATCAAGCATTC pLKO_005 2038 CDS 100% 6.000 4.200 N PLAGL2 n/a
11 TRCN0000220187 CGGTAAGAATTACAATACGAA pLKO.1 969 CDS 100% 3.000 2.100 N PLAGL2 n/a
12 TRCN0000220186 GCTTGGATCTACCTCATACTT pLKO.1 1602 CDS 100% 5.625 3.375 N PLAGL2 n/a
13 TRCN0000238409 CCTCATACTTGCCCGACAAAC pLKO_005 1613 CDS 100% 10.800 7.560 N Plagl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.