Transcript: Human XM_005260938.5

PREDICTED: Homo sapiens GA binding protein transcription factor subunit alpha (GABPA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABPA (2551)
Length:
4459
CDS:
223..1587

Additional Resources:

NCBI RefSeq record:
XM_005260938.5
NBCI Gene record:
GABPA (2551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260938.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235697 AGCTTAGTGTACAGGTAATTT pLKO_005 500 CDS 100% 15.000 21.000 N GABPA n/a
2 TRCN0000304469 AGCTTAGTGTACAGGTAATTT pLKO_005 500 CDS 100% 15.000 21.000 N Gabpa n/a
3 TRCN0000018290 GCTAGAACTTCTTACTGATAA pLKO.1 1200 CDS 100% 13.200 10.560 N GABPA n/a
4 TRCN0000235696 ATGAACCAATAGGCAATTTAA pLKO_005 356 CDS 100% 15.000 10.500 N GABPA n/a
5 TRCN0000304508 ATGAACCAATAGGCAATTTAA pLKO_005 356 CDS 100% 15.000 10.500 N Gabpa n/a
6 TRCN0000235695 CATAGGTAATGTGACTAATTT pLKO_005 3832 3UTR 100% 15.000 10.500 N GABPA n/a
7 TRCN0000235694 GCTACACCTACTACCATTAAA pLKO_005 1057 CDS 100% 15.000 10.500 N GABPA n/a
8 TRCN0000235698 ACCTCACCACACTCAACATTT pLKO_005 854 CDS 100% 13.200 9.240 N GABPA n/a
9 TRCN0000018289 CGAGGATTTCAGGAGAAGATA pLKO.1 1121 CDS 100% 5.625 3.938 N GABPA n/a
10 TRCN0000018288 GCAGCTTATATTCCTTTGTTT pLKO.1 2478 3UTR 100% 5.625 3.938 N GABPA n/a
11 TRCN0000018291 GAGGTTGTTATTGATCCAGAT pLKO.1 583 CDS 100% 4.050 2.835 N GABPA n/a
12 TRCN0000018292 CTGTGCAAATTATTCCAGCAT pLKO.1 1025 CDS 100% 2.640 1.848 N GABPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260938.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.