Transcript: Human XM_005261571.4

PREDICTED: Homo sapiens desumoylating isopeptidase 1 (DESI1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DESI1 (27351)
Length:
1547
CDS:
239..868

Additional Resources:

NCBI RefSeq record:
XM_005261571.4
NBCI Gene record:
DESI1 (27351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261571.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141997 GCGGAAGATTCCTTCTTACAT pLKO.1 601 CDS 100% 5.625 4.500 N DESI1 n/a
2 TRCN0000140006 GAGGCCTACAACCTCTTTGAA pLKO.1 533 CDS 100% 5.625 3.938 N DESI1 n/a
3 TRCN0000145540 CTACAACCTCTTTGAACACAA pLKO.1 538 CDS 100% 4.950 3.465 N DESI1 n/a
4 TRCN0000141462 GCACAAGGATGAGTTCTTCTT pLKO.1 367 CDS 100% 4.950 3.465 N DESI1 n/a
5 TRCN0000139883 GATGAGTTCTTCTTCGGCAGT pLKO.1 374 CDS 100% 2.160 1.512 N DESI1 n/a
6 TRCN0000144328 CAGAAGAAATCTTTCTGGAGT pLKO.1 477 CDS 100% 0.264 0.185 N DESI1 n/a
7 TRCN0000140293 GCACACATCCATAGTTGTGCA pLKO.1 349 CDS 100% 0.264 0.185 N DESI1 n/a
8 TRCN0000144327 CAGAAGTCACAGAAGAAATCT pLKO.1 468 CDS 100% 5.625 3.375 N DESI1 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1445 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261571.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.