Transcript: Human XM_005262201.2

PREDICTED: Homo sapiens tRNA methyltransferase 2 homolog B (TRMT2B), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRMT2B (79979)
Length:
5160
CDS:
622..1419

Additional Resources:

NCBI RefSeq record:
XM_005262201.2
NBCI Gene record:
TRMT2B (79979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275386 CATCAATGGTTACCGAAATAA pLKO_005 348 5UTR 100% 15.000 21.000 N TRMT2B n/a
2 TRCN0000154263 CGGCTGACTTAACCTTAGATT pLKO.1 1872 3UTR 100% 5.625 7.875 N TRMT2B n/a
3 TRCN0000275434 CGGCTGACTTAACCTTAGATT pLKO_005 1872 3UTR 100% 5.625 7.875 N TRMT2B n/a
4 TRCN0000158194 CCTGTCATCAATGGTTACCGA pLKO.1 343 5UTR 100% 0.750 1.050 N TRMT2B n/a
5 TRCN0000154262 CATGGTGAATCCACTAGGAAT pLKO.1 1264 CDS 100% 4.950 3.465 N TRMT2B n/a
6 TRCN0000158351 CCATGGTGAATCCACTAGGAA pLKO.1 1263 CDS 100% 3.000 2.100 N TRMT2B n/a
7 TRCN0000153471 CTGGTCAAGCAGAGAAGATTT pLKO.1 1097 CDS 100% 13.200 7.920 N TRMT2B n/a
8 TRCN0000275384 CTGGTCAAGCAGAGAAGATTT pLKO_005 1097 CDS 100% 13.200 7.920 N TRMT2B n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1755 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000104022 GCTGTACCTGTGGATTTGTTT pLKO.1 1354 CDS 100% 5.625 3.938 N Trmt2b n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4593 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4418 3UTR 100% 4.950 2.475 Y C16orf89 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4593 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.