Transcript: Human XM_005262270.1

PREDICTED: Homo sapiens oligophrenin 1 (OPHN1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OPHN1 (4983)
Length:
6210
CDS:
365..2449

Additional Resources:

NCBI RefSeq record:
XM_005262270.1
NBCI Gene record:
OPHN1 (4983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047970 GCGCTATGAGAAATTATTCTT pLKO.1 507 CDS 100% 5.625 7.875 N OPHN1 n/a
2 TRCN0000047972 CCATACAAACAACAGCTCCAA pLKO.1 1031 CDS 100% 2.640 3.696 N OPHN1 n/a
3 TRCN0000286709 CCATACAAACAACAGCTCCAA pLKO_005 1031 CDS 100% 2.640 3.696 N OPHN1 n/a
4 TRCN0000306865 CACTTTGGCAAGATCTATTTA pLKO_005 2039 CDS 100% 15.000 12.000 N OPHN1 n/a
5 TRCN0000047969 GCTAGTGATTTGCTGATTAAA pLKO.1 686 CDS 100% 15.000 10.500 N OPHN1 n/a
6 TRCN0000286708 GCTAGTGATTTGCTGATTAAA pLKO_005 686 CDS 100% 15.000 10.500 N OPHN1 n/a
7 TRCN0000294065 CCTTTGTGTGCGGAGTCATTT pLKO_005 2521 3UTR 100% 13.200 9.240 N OPHN1 n/a
8 TRCN0000047968 CGCCATGATGAACATCAAATT pLKO.1 1987 CDS 100% 13.200 9.240 N OPHN1 n/a
9 TRCN0000380315 CGCGAGAGGCTCAAGTGTTAT pLKO_005 419 CDS 100% 13.200 9.240 N OPHN1 n/a
10 TRCN0000047971 CCTATCTACCACAGCCCTATA pLKO.1 1466 CDS 100% 10.800 7.560 N OPHN1 n/a
11 TRCN0000286783 CCTATCTACCACAGCCCTATA pLKO_005 1466 CDS 100% 10.800 7.560 N OPHN1 n/a
12 TRCN0000382316 CAGAACCAAAGCCAGATATTG pLKO_005 2310 CDS 100% 13.200 7.920 N OPHN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.