Transcript: Human XM_005262456.4

PREDICTED: Homo sapiens BCL6 corepressor like 1 (BCORL1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCORL1 (63035)
Length:
7373
CDS:
461..5428

Additional Resources:

NCBI RefSeq record:
XM_005262456.4
NBCI Gene record:
BCORL1 (63035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262456.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033475 CGAGTGAAACAGGAAAGCGTA pLKO.1 3728 CDS 100% 2.640 3.696 N BCORL1 n/a
2 TRCN0000033478 CCAAACGGTTTCCTCCCAAAT pLKO.1 4256 CDS 100% 10.800 7.560 N BCORL1 n/a
3 TRCN0000085728 GCCTTATCAATGCCAGCATTA pLKO.1 5551 3UTR 100% 10.800 7.560 N Bcorl1 n/a
4 TRCN0000033477 CCTTATGAAGAACAAGTCAAT pLKO.1 3200 CDS 100% 4.950 3.465 N BCORL1 n/a
5 TRCN0000033474 CGCCTTATCAATGCCAGCATT pLKO.1 5550 3UTR 100% 4.950 3.465 N BCORL1 n/a
6 TRCN0000033476 GCACTTTGAAATCACCACCAT pLKO.1 5224 CDS 100% 2.640 1.848 N BCORL1 n/a
7 TRCN0000063023 CCTCCTCTTCTTTCTCCTTTA pLKO.1 5443 3UTR 100% 10.800 5.400 Y KIR3DL2 n/a
8 TRCN0000056930 CTCCTCTTCTTTCTCCTTCAT pLKO.1 5444 3UTR 100% 4.950 2.475 Y KIR2DS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262456.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.