Transcript: Human XM_005262796.2

PREDICTED: Homo sapiens epidermal growth factor (EGF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EGF (1950)
Length:
5608
CDS:
454..4101

Additional Resources:

NCBI RefSeq record:
XM_005262796.2
NBCI Gene record:
EGF (1950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415996 ACATCCAACACAGCATAATTT pLKO_005 1179 CDS 100% 15.000 21.000 N EGF n/a
2 TRCN0000421700 TCCACAATCTCTACGACTAAT pLKO_005 4195 3UTR 100% 13.200 18.480 N EGF n/a
3 TRCN0000055479 CCACCACTATTCCGTAAGAAA pLKO.1 3345 CDS 100% 5.625 7.875 N EGF n/a
4 TRCN0000055481 GCTAACCCATTATGGCAACAA pLKO.1 4039 CDS 100% 4.950 6.930 N EGF n/a
5 TRCN0000429894 TAGCAGTGTTTGAGGATTATG pLKO_005 2522 CDS 100% 13.200 9.240 N EGF n/a
6 TRCN0000415645 TGGATAGAGAGAGCTAATATG pLKO_005 2056 CDS 100% 13.200 9.240 N EGF n/a
7 TRCN0000055480 CCACGAGGAATTGCTGTTCAT pLKO.1 2251 CDS 100% 4.950 3.465 N EGF n/a
8 TRCN0000055482 CCCTTATGTTTCTGTCCTGAA pLKO.1 1708 CDS 100% 4.050 2.835 N EGF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.