Transcript: Human XM_005263102.4

PREDICTED: Homo sapiens SDA1 domain containing 1 (SDAD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SDAD1 (55153)
Length:
3080
CDS:
253..2241

Additional Resources:

NCBI RefSeq record:
XM_005263102.4
NBCI Gene record:
SDAD1 (55153)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129836 CCCAGAGTACCTAAGTAATTT pLKO.1 387 CDS 100% 15.000 10.500 N SDAD1 n/a
2 TRCN0000281085 CCCAGAGTACCTAAGTAATTT pLKO_005 387 CDS 100% 15.000 10.500 N SDAD1 n/a
3 TRCN0000281088 AGAGACCTGCTAGTACAATAT pLKO_005 907 CDS 100% 13.200 9.240 N SDAD1 n/a
4 TRCN0000129412 GCTGAACATGTGGCAGCAATT pLKO.1 2362 3UTR 100% 10.800 7.560 N SDAD1 n/a
5 TRCN0000281087 GCTGAACATGTGGCAGCAATT pLKO_005 2362 3UTR 100% 10.800 7.560 N SDAD1 n/a
6 TRCN0000247857 ACTTTATGATGATGCGGTATA pLKO_005 2126 CDS 100% 10.800 6.480 N Sdad1 n/a
7 TRCN0000215993 CTTTATGATGATGCGGTATAG pLKO.1 2127 CDS 100% 10.800 6.480 N Sdad1 n/a
8 TRCN0000130245 CCGATGAAGAACAGCAAGAAA pLKO.1 1733 CDS 100% 5.625 3.375 N SDAD1 n/a
9 TRCN0000281084 CCGATGAAGAACAGCAAGAAA pLKO_005 1733 CDS 100% 5.625 3.375 N SDAD1 n/a
10 TRCN0000146546 CAAGATATTAGTTGCCGCTTT pLKO.1 810 CDS 100% 4.050 2.430 N SDAD1 n/a
11 TRCN0000281086 CAAGATATTAGTTGCCGCTTT pLKO_005 810 CDS 100% 4.050 2.430 N SDAD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.