Transcript: Human XM_005263215.3

PREDICTED: Homo sapiens Rho GTPase activating protein 10 (ARHGAP10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP10 (79658)
Length:
3144
CDS:
237..2444

Additional Resources:

NCBI RefSeq record:
XM_005263215.3
NBCI Gene record:
ARHGAP10 (79658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413448 GCCGTTGAAACACGAGGTATA pLKO_005 1449 CDS 100% 10.800 15.120 N ARHGAP10 n/a
2 TRCN0000048474 CTCGTGTTAATGCGATCCATT pLKO.1 1705 CDS 100% 4.950 6.930 N ARHGAP10 n/a
3 TRCN0000430704 CAGAACACAGCTCGGAATTAT pLKO_005 2305 CDS 100% 15.000 10.500 N ARHGAP10 n/a
4 TRCN0000433233 GAGTATGTTGATGGATGTAAA pLKO_005 1526 CDS 100% 13.200 9.240 N ARHGAP10 n/a
5 TRCN0000426719 GATGCTTCCTTACGTGAATTT pLKO_005 486 CDS 100% 13.200 9.240 N ARHGAP10 n/a
6 TRCN0000048473 GCCCTCATGGACTTGAAGTTT pLKO.1 1890 CDS 100% 5.625 3.938 N ARHGAP10 n/a
7 TRCN0000048476 GATTCCACAGAACTACGTCAA pLKO.1 2414 CDS 100% 4.050 2.835 N ARHGAP10 n/a
8 TRCN0000048475 GCCTCTCATGACCTATGAGTT pLKO.1 1640 CDS 100% 0.495 0.347 N ARHGAP10 n/a
9 TRCN0000048477 GCCAGAGAAGAATAAAGAGAT pLKO.1 1742 CDS 100% 4.950 2.970 N ARHGAP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.