Transcript: Human XM_005263397.1

PREDICTED: Homo sapiens calmodulin regulated spectrin associated protein 1 (CAMSAP1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMSAP1 (157922)
Length:
7157
CDS:
361..4335

Additional Resources:

NCBI RefSeq record:
XM_005263397.1
NBCI Gene record:
CAMSAP1 (157922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243103 AGAAGGCCCAGACTCGTAAAT pLKO_005 4313 CDS 100% 13.200 18.480 N CAMSAP1 n/a
2 TRCN0000243104 TAAATCAAACAAGCCGATTAT pLKO_005 3942 CDS 100% 13.200 18.480 N CAMSAP1 n/a
3 TRCN0000172863 GAAAGCAATCAGCGGACACTT pLKO.1 3046 CDS 100% 4.950 6.930 N CAMSAP1 n/a
4 TRCN0000243100 AGTTTCAGACACAGGATTAAT pLKO_005 6478 3UTR 100% 15.000 10.500 N CAMSAP1 n/a
5 TRCN0000243101 GACACCGAGGGAAGGTTATAT pLKO_005 1654 CDS 100% 15.000 10.500 N CAMSAP1 n/a
6 TRCN0000172862 GAAGAGGAGCTTGTGGCTATT pLKO.1 1141 CDS 100% 10.800 7.560 N CAMSAP1 n/a
7 TRCN0000172608 GCCATTAGTGTTGAAGCCGAA pLKO.1 459 CDS 100% 2.160 1.512 N CAMSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.