Transcript: Human XM_005263908.4

PREDICTED: Homo sapiens non-SMC condensin I complex subunit H (NCAPH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCAPH (23397)
Length:
2789
CDS:
65..2242

Additional Resources:

NCBI RefSeq record:
XM_005263908.4
NBCI Gene record:
NCAPH (23397)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263908.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415533 CACCGAACCAACCAACTTTAA pLKO_005 499 CDS 100% 13.200 18.480 N NCAPH n/a
2 TRCN0000118061 ACACGCAGATTACGGAACATT pLKO.1 375 CDS 100% 5.625 7.875 N NCAPH n/a
3 TRCN0000118058 CCCAAGGATTAGACATCACAA pLKO.1 1887 CDS 100% 4.950 3.465 N NCAPH n/a
4 TRCN0000118057 CCTGTTTGTTTGTTGCTCTTT pLKO.1 2426 3UTR 100% 4.950 3.465 N NCAPH n/a
5 TRCN0000118059 GCACCGTCTTTGGAAGAAGTA pLKO.1 623 CDS 100% 4.950 3.465 N NCAPH n/a
6 TRCN0000416499 ACTGACTCACCTCGCTTATTG pLKO_005 299 CDS 100% 13.200 7.920 N NCAPH n/a
7 TRCN0000118060 CCACAATGAATAACTCTTCTT pLKO.1 93 CDS 100% 4.950 2.970 N NCAPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263908.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.