Transcript: Human XM_005264144.1

PREDICTED: Homo sapiens transmembrane protein 178A (TMEM178A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM178A (130733)
Length:
1526
CDS:
59..814

Additional Resources:

NCBI RefSeq record:
XM_005264144.1
NBCI Gene record:
TMEM178A (130733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166916 CGTAACAAAGCGAGTATAATT pLKO.1 1175 3UTR 100% 15.000 21.000 N TMEM178A n/a
2 TRCN0000168186 CGCCAGTATCTCGTATGATTT pLKO.1 607 CDS 100% 13.200 18.480 N TMEM178A n/a
3 TRCN0000167087 CAGTATCTCGTATGATTTGAA pLKO.1 610 CDS 100% 5.625 7.875 N TMEM178A n/a
4 TRCN0000172395 CACCCTCATCCTGAAAGGTAT pLKO.1 442 CDS 100% 4.950 6.930 N TMEM178A n/a
5 TRCN0000172872 GCACCATTTCCCTCTGTACTT pLKO.1 582 CDS 100% 4.950 3.960 N TMEM178A n/a
6 TRCN0000216733 GCATCGCTTATCCGTTTATTA pLKO.1 744 CDS 100% 15.000 10.500 N Tmem178 n/a
7 TRCN0000172281 CCGCTTGCGAAACATTCCTTT pLKO.1 508 CDS 100% 4.950 3.465 N TMEM178A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.