Transcript: Human XM_005264395.4

PREDICTED: Homo sapiens FA complementation group L (FANCL), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FANCL (55120)
Length:
1945
CDS:
60..1211

Additional Resources:

NCBI RefSeq record:
XM_005264395.4
NBCI Gene record:
FANCL (55120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264395.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083299 GCCTTATTGAAGAGATAGGAA pLKO.1 397 CDS 100% 3.000 4.200 N FANCL n/a
2 TRCN0000301019 GCCTTATTGAAGAGATAGGAA pLKO_005 397 CDS 100% 3.000 4.200 N FANCL n/a
3 TRCN0000323352 TGCAGAATCACCAGATTATTT pLKO_005 536 CDS 100% 15.000 10.500 N FANCL n/a
4 TRCN0000083301 GCAGAATTGCATTAGGTAATA pLKO.1 736 CDS 100% 13.200 9.240 N FANCL n/a
5 TRCN0000301086 GCAGAATTGCATTAGGTAATA pLKO_005 736 CDS 100% 13.200 9.240 N FANCL n/a
6 TRCN0000083302 GCTGAGCAGGAACATACATTT pLKO.1 857 CDS 100% 13.200 9.240 N FANCL n/a
7 TRCN0000301012 GCTGAGCAGGAACATACATTT pLKO_005 857 CDS 100% 13.200 9.240 N FANCL n/a
8 TRCN0000083300 CCTTTCCATCAAATATGCTTA pLKO.1 1053 CDS 100% 4.950 3.465 N FANCL n/a
9 TRCN0000083298 GCCTGAAGATTTACAACTGAA pLKO.1 185 CDS 100% 4.950 3.465 N FANCL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264395.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.