Transcript: Human XM_005264689.5

PREDICTED: Homo sapiens ALK and LTK ligand 2 (ALKAL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALKAL2 (285016)
Length:
1416
CDS:
369..827

Additional Resources:

NCBI RefSeq record:
XM_005264689.5
NBCI Gene record:
ALKAL2 (285016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264689.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372311 TTTGACGTGTAGTGCTATAAA pLKO_005 1076 3UTR 100% 15.000 21.000 N ALKAL2 n/a
2 TRCN0000372312 ACCATTCCTGCATACTATAAA pLKO_005 744 CDS 100% 15.000 10.500 N ALKAL2 n/a
3 TRCN0000164589 CCTTACAGGCCCTCTTTATTT pLKO.1 668 CDS 100% 15.000 10.500 N ALKAL2 n/a
4 TRCN0000158545 CAAACACTTCCATAGACTTTA pLKO.1 704 CDS 100% 13.200 9.240 N ALKAL2 n/a
5 TRCN0000163595 CCAACAGGGAAACAGAACTAT pLKO.1 879 3UTR 100% 5.625 3.938 N ALKAL2 n/a
6 TRCN0000161489 GCAAACACTTCCATAGACTTT pLKO.1 703 CDS 100% 4.950 3.465 N ALKAL2 n/a
7 TRCN0000166277 CAGCGAGTGGAAATTGTTCCT pLKO.1 612 CDS 100% 2.640 1.848 N ALKAL2 n/a
8 TRCN0000159124 GATGAAGGACAAGTTTCTAAA pLKO.1 644 CDS 100% 13.200 7.920 N ALKAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264689.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.