Transcript: Human XM_005264917.3

PREDICTED: Homo sapiens dedicator of cytokinesis 3 (DOCK3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK3 (1795)
Length:
9108
CDS:
296..6469

Additional Resources:

NCBI RefSeq record:
XM_005264917.3
NBCI Gene record:
DOCK3 (1795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122975 CCGCTGTTTGAAGTGGTATAT pLKO.1 2407 CDS 100% 13.200 10.560 N DOCK3 n/a
2 TRCN0000427237 GGGATTGCAAGGACCATATAG pLKO_005 6933 3UTR 100% 13.200 10.560 N DOCK3 n/a
3 TRCN0000122978 GTTCAGACATTGTTCCACAAA pLKO.1 1819 CDS 100% 4.950 3.960 N DOCK3 n/a
4 TRCN0000418862 GATGAGAATAGCACGTTTAAT pLKO_005 1946 CDS 100% 15.000 10.500 N DOCK3 n/a
5 TRCN0000122974 CCCAGCTTGTTTAACAGAAAT pLKO.1 8086 3UTR 100% 13.200 9.240 N DOCK3 n/a
6 TRCN0000122977 CCTCTGCATAAGAAGCTAATT pLKO.1 5081 CDS 100% 13.200 9.240 N DOCK3 n/a
7 TRCN0000122976 GCCAGCTACTATGACAACATT pLKO.1 4265 CDS 100% 5.625 3.938 N DOCK3 n/a
8 TRCN0000105687 CCCAGAGAAGATAGAACGAAT pLKO.1 1087 CDS 100% 4.950 3.465 N Dock3 n/a
9 TRCN0000105688 CCATGTGATGAATGAACTTAT pLKO.1 643 CDS 100% 13.200 7.920 N Dock3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.