Transcript: Human XM_005265221.3

PREDICTED: Homo sapiens Scm like with four mbt domains 1 (SFMBT1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SFMBT1 (51460)
Length:
9032
CDS:
505..3105

Additional Resources:

NCBI RefSeq record:
XM_005265221.3
NBCI Gene record:
SFMBT1 (51460)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148746 CCTTCAGCCATTAGACATCTA pLKO.1 1198 CDS 100% 4.950 6.930 N SFMBT1 n/a
2 TRCN0000147815 GAAGCCTATACCTGAATGTAT pLKO.1 1770 CDS 100% 5.625 4.500 N SFMBT1 n/a
3 TRCN0000146761 CAGAATAAGAAGACCCTTGAA pLKO.1 838 CDS 100% 4.950 3.465 N SFMBT1 n/a
4 TRCN0000147760 GCTACTGTTGAGATAGTGAAA pLKO.1 2257 CDS 100% 4.950 3.465 N SFMBT1 n/a
5 TRCN0000150138 GTAGAATTAAGCTGGGAAGAT pLKO.1 556 CDS 100% 4.950 3.465 N SFMBT1 n/a
6 TRCN0000146760 CCAAAGGAAATAAGGATCGAA pLKO.1 2830 CDS 100% 3.000 2.100 N SFMBT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.