Transcript: Human XM_005265581.4

PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit alpha2delta 2 (CACNA2D2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNA2D2 (9254)
Length:
5350
CDS:
49..3483

Additional Resources:

NCBI RefSeq record:
XM_005265581.4
NBCI Gene record:
CACNA2D2 (9254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265581.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271325 CGAAGGAGACCCTGGTATATC pLKO_005 877 CDS 100% 13.200 18.480 N CACNA2D2 n/a
2 TRCN0000045084 CCGTGAGATTTACAAGGACAA pLKO.1 330 CDS 100% 4.050 5.670 N CACNA2D2 n/a
3 TRCN0000045086 CGAGGTTAACAATGAGGACTT pLKO.1 2673 CDS 100% 4.050 5.670 N CACNA2D2 n/a
4 TRCN0000045083 CCGCATCAACACACAGGAATA pLKO.1 1422 CDS 100% 10.800 8.640 N CACNA2D2 n/a
5 TRCN0000271326 GTGCCAACAAAGGCTACTATT pLKO_005 1376 CDS 100% 13.200 9.240 N CACNA2D2 n/a
6 TRCN0000271267 TCAAGAACAAGGTCAACTATT pLKO_005 638 CDS 100% 13.200 9.240 N CACNA2D2 n/a
7 TRCN0000271268 ACCATTCATTCTGGTCATTTC pLKO_005 4709 3UTR 100% 10.800 7.560 N CACNA2D2 n/a
8 TRCN0000045087 CGTGGCTCTGAATGACATCAA pLKO.1 1632 CDS 100% 4.950 3.465 N CACNA2D2 n/a
9 TRCN0000045085 GCGCAACAAGAAGGTGTTCAA pLKO.1 1098 CDS 100% 4.950 3.465 N CACNA2D2 n/a
10 TRCN0000271264 ACTACACCTGGGTGCCTATAA pLKO_005 1919 CDS 100% 13.200 7.920 N CACNA2D2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4659 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265581.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.