Transcript: Human XM_005266444.3

PREDICTED: Homo sapiens GPALPP motifs containing 1 (GPALPP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPALPP1 (55425)
Length:
1513
CDS:
118..1140

Additional Resources:

NCBI RefSeq record:
XM_005266444.3
NBCI Gene record:
GPALPP1 (55425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264350 ATACCATTTGACCGTGATAAA pLKO_005 1012 CDS 100% 13.200 18.480 N Gpalpp1 n/a
2 TRCN0000134800 CTCAAGGTTAATCGGTTTGAT pLKO.1 1036 CDS 100% 5.625 7.875 N GPALPP1 n/a
3 TRCN0000134564 GATCTCAAGGTTAATCGGTTT pLKO.1 1033 CDS 100% 4.050 5.670 N GPALPP1 n/a
4 TRCN0000134582 GAATACCATTTGACCGTGATA pLKO.1 1010 CDS 100% 4.950 3.960 N GPALPP1 n/a
5 TRCN0000216626 GATAAAGATCTCAAGGTTAAT pLKO.1 1027 CDS 100% 13.200 9.240 N Gpalpp1 n/a
6 TRCN0000416813 TCACACGGCAAAGGCAATATG pLKO_005 1111 CDS 100% 13.200 9.240 N GPALPP1 n/a
7 TRCN0000425277 ACATCTGGAGATCGATCAATC pLKO_005 763 CDS 100% 10.800 7.560 N GPALPP1 n/a
8 TRCN0000133765 CCTCCAGAAATGAAAGACTTT pLKO.1 703 CDS 100% 4.950 3.465 N GPALPP1 n/a
9 TRCN0000136486 CAGGATGATGACGATGATGAT pLKO.1 355 CDS 100% 4.950 2.970 N GPALPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.