Transcript: Human XM_005266726.5

PREDICTED: Homo sapiens zinc finger protein 407 (ZNF407), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF407 (55628)
Length:
15466
CDS:
7517..14263

Additional Resources:

NCBI RefSeq record:
XM_005266726.5
NBCI Gene record:
ZNF407 (55628)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266726.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235895 AGCCACCGAGAAGCATATTAA pLKO_005 9418 CDS 100% 15.000 21.000 N ZNF407 n/a
2 TRCN0000235896 GTCGTACGAGTGCCGTCTAAA pLKO_005 12958 CDS 100% 13.200 18.480 N ZNF407 n/a
3 TRCN0000235893 TCCCATTTGACTCGGCATAAA pLKO_005 12695 CDS 100% 13.200 18.480 N ZNF407 n/a
4 TRCN0000235897 TGCAGGATTTCTTCGTGATTT pLKO_005 15133 3UTR 100% 13.200 9.240 N ZNF407 n/a
5 TRCN0000018100 GCAGCAACAGAGAAGCACAAA pLKO.1 10709 CDS 100% 4.950 3.465 N ZNF407 n/a
6 TRCN0000018101 GCCACTTATGTGATAGAAGTT pLKO.1 12405 CDS 100% 4.950 3.465 N ZNF407 n/a
7 TRCN0000018102 CCTTAAATTGTGAGACAGCAA pLKO.1 11136 CDS 100% 2.640 1.848 N ZNF407 n/a
8 TRCN0000018099 CCTTTGATTCTGAACAGAATT pLKO.1 11997 CDS 100% 0.000 0.000 N ZNF407 n/a
9 TRCN0000235894 GCCAAGACCTGAGCGAAATAT pLKO_005 8755 CDS 100% 15.000 9.000 N ZNF407 n/a
10 TRCN0000018098 GCCCTGAACAACCACATGAAA pLKO.1 12440 CDS 100% 5.625 3.375 N ZNF407 n/a
11 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 58 5UTR 100% 13.200 6.600 Y LRRC74B n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 22 5UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266726.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.