Transcript: Human XM_005267421.4

PREDICTED: Homo sapiens pecanex 1 (PCNX1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCNX1 (22990)
Length:
12901
CDS:
409..7455

Additional Resources:

NCBI RefSeq record:
XM_005267421.4
NBCI Gene record:
PCNX1 (22990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267421.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129177 CGACCTAAATCTTCTAGCGTA pLKO.1 2035 CDS 100% 2.640 3.696 N PCNX1 n/a
2 TRCN0000130431 GCTTCCCAGCTTGATAGAAAT pLKO.1 5041 CDS 100% 13.200 9.240 N PCNX1 n/a
3 TRCN0000128898 GCGTAAAGATGTTGGTGGAAA pLKO.1 1995 CDS 100% 4.950 3.465 N PCNX1 n/a
4 TRCN0000129724 CCTGAAAGTATAAAGCCCTTA pLKO.1 2536 CDS 100% 4.050 2.835 N PCNX1 n/a
5 TRCN0000128233 GCAGCAACTATTAAAGGAGAT pLKO.1 907 CDS 100% 4.050 2.835 N PCNX1 n/a
6 TRCN0000130288 CCTATTGGCTACCCAATCTTT pLKO.1 6391 CDS 100% 0.563 0.394 N PCNX1 n/a
7 TRCN0000128979 GCCAACAATTCACACTCCAAA pLKO.1 7126 CDS 100% 4.950 6.930 N PCNX1 n/a
8 TRCN0000216365 GACATGGTCATAATCGTATTA pLKO.1 3584 CDS 100% 13.200 9.240 N Pcnx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267421.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.