Transcript: Human XM_005267431.1

PREDICTED: Homo sapiens dishevelled associated activator of morphogenesis 1 (DAAM1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DAAM1 (23002)
Length:
6078
CDS:
296..3532

Additional Resources:

NCBI RefSeq record:
XM_005267431.1
NBCI Gene record:
DAAM1 (23002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431197 ACGGAATCGCAAACGTATTAC pLKO_005 3457 CDS 100% 13.200 18.480 N DAAM1 n/a
2 TRCN0000414841 GTCGTACGAATGTTGGTTAAT pLKO_005 1598 CDS 100% 13.200 18.480 N DAAM1 n/a
3 TRCN0000413608 AGGAACAGTATGGACCGAAAT pLKO_005 2167 CDS 100% 10.800 15.120 N DAAM1 n/a
4 TRCN0000419586 TAGTGAAGCTTACCCGCATTT pLKO_005 1414 CDS 100% 10.800 8.640 N DAAM1 n/a
5 TRCN0000123000 CGCTATGAATTTCTGATGTTA pLKO.1 1208 CDS 100% 5.625 4.500 N DAAM1 n/a
6 TRCN0000429241 GGCTCATTCTGAGAGTATTAA pLKO_005 892 CDS 100% 15.000 10.500 N DAAM1 n/a
7 TRCN0000422055 AGACCTATACGTATGGTTAAA pLKO_005 3727 3UTR 100% 13.200 9.240 N DAAM1 n/a
8 TRCN0000423944 GCTCATTAGCAGCCCTCTAAA pLKO_005 3560 3UTR 100% 13.200 9.240 N DAAM1 n/a
9 TRCN0000412638 AGACATTCCCTAGATTCAAAG pLKO_005 3875 3UTR 100% 10.800 7.560 N DAAM1 n/a
10 TRCN0000420595 CAACGTGAAAGGGAACGTAAA pLKO_005 3332 CDS 100% 10.800 7.560 N DAAM1 n/a
11 TRCN0000421053 GACGAAATCAAACGGGCAATT pLKO_005 2417 CDS 100% 10.800 7.560 N DAAM1 n/a
12 TRCN0000123001 CCTATCATGTATCCTCAACTT pLKO.1 766 CDS 100% 4.950 3.465 N DAAM1 n/a
13 TRCN0000120533 CCTGGCTCATTCTGAGAGTAT pLKO.1 889 CDS 100% 4.950 3.465 N Daam1 n/a
14 TRCN0000122999 GCACAATACTATCTCCTGAAA pLKO.1 3846 3UTR 100% 4.950 3.465 N DAAM1 n/a
15 TRCN0000123003 GCAGAAGCTAAAGACCTGTTT pLKO.1 3134 CDS 100% 4.950 3.465 N DAAM1 n/a
16 TRCN0000123002 GCGTTAATGAACAACTCTCAA pLKO.1 854 CDS 100% 4.950 3.465 N DAAM1 n/a
17 TRCN0000120535 CGGGCAATTCTAACAATGGAT pLKO.1 2429 CDS 100% 3.000 2.100 N Daam1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.