Transcript: Human XM_005268371.1

PREDICTED: Homo sapiens synaptopodin (SYNPO), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYNPO (11346)
Length:
5244
CDS:
406..3117

Additional Resources:

NCBI RefSeq record:
XM_005268371.1
NBCI Gene record:
SYNPO (11346)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218429 AGTTACTTGTTACGGGAAATA pLKO_005 4101 3UTR 100% 13.200 18.480 N SYNPO n/a
2 TRCN0000230911 CATGCTAGAGAGACGACATTT pLKO_005 1179 CDS 100% 13.200 18.480 N SYNPO n/a
3 TRCN0000230913 GAGGTCTCCTCCCTCATATTC pLKO_005 1407 CDS 100% 13.200 18.480 N SYNPO n/a
4 TRCN0000008655 CCGCAAATCCATGTTTACTTT pLKO.1 1533 CDS 100% 5.625 7.875 N SYNPO n/a
5 TRCN0000008656 CTGGCGCGAAACATCATCAAT pLKO.1 2674 CDS 100% 5.625 7.875 N SYNPO n/a
6 TRCN0000008657 CACTCCTAATTGACAAGGTAT pLKO.1 866 CDS 100% 4.950 6.930 N SYNPO n/a
7 TRCN0000008654 CCCTCATATTCTGTCCTGTAT pLKO.1 1417 CDS 100% 4.950 3.465 N SYNPO n/a
8 TRCN0000008653 GAGCCAGAAGAAGGCTCATTA pLKO.1 3150 3UTR 100% 1.320 0.924 N SYNPO n/a
9 TRCN0000218782 ACCACTGGTGGTTTATCTAAA pLKO_005 477 CDS 100% 13.200 7.920 N SYNPO n/a
10 TRCN0000230912 CCGGCCACAGAGACACATAAT pLKO_005 1251 CDS 100% 13.200 7.920 N SYNPO n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3463 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.