Transcript: Human XM_005268454.5

PREDICTED: Homo sapiens protocadherin 1 (PCDH1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCDH1 (5097)
Length:
3534
CDS:
59..3451

Additional Resources:

NCBI RefSeq record:
XM_005268454.5
NBCI Gene record:
PCDH1 (5097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268454.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434207 GCCAATGCAGAAATCGAATAC pLKO_005 1037 CDS 100% 10.800 15.120 N PCDH1 n/a
2 TRCN0000055562 GCTTTGATCGAGAGCAACAAA pLKO.1 2121 CDS 100% 5.625 7.875 N PCDH1 n/a
3 TRCN0000423866 ACGTTGGTGTCACCATCAATG pLKO_005 2199 CDS 100% 10.800 7.560 N PCDH1 n/a
4 TRCN0000055559 CCTGGAGTTTGAGGTATCTAT pLKO.1 505 CDS 100% 5.625 3.938 N PCDH1 n/a
5 TRCN0000055560 GCTCTAATGCTGAGCTGGTTT pLKO.1 1713 CDS 100% 4.950 3.465 N PCDH1 n/a
6 TRCN0000055558 GCTGAGCTGATCTACAGCATT pLKO.1 2354 CDS 100% 4.950 3.465 N PCDH1 n/a
7 TRCN0000055561 CGTGCTTGACACCAATGACAA pLKO.1 913 CDS 100% 4.950 2.970 N PCDH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268454.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.