Transcript: Human XM_005268571.3

PREDICTED: Homo sapiens Rap guanine nucleotide exchange factor 3 (RAPGEF3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAPGEF3 (10411)
Length:
3156
CDS:
1345..2832

Additional Resources:

NCBI RefSeq record:
XM_005268571.3
NBCI Gene record:
RAPGEF3 (10411)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425229 AGGGCACTTCGTGGTACATTA pLKO_005 930 5UTR 100% 13.200 18.480 N RAPGEF3 n/a
2 TRCN0000047228 GCAGGACTTCAACCGTATCAT pLKO.1 1111 5UTR 100% 5.625 4.500 N RAPGEF3 n/a
3 TRCN0000423319 AGTACCACCTTAGGCTCTATC pLKO_005 453 5UTR 100% 10.800 7.560 N RAPGEF3 n/a
4 TRCN0000424456 GGCTCAATGAGCGTCTCTTTG pLKO_005 1934 CDS 100% 10.800 7.560 N RAPGEF3 n/a
5 TRCN0000047230 CTCAAAGACATGACCTTCATT pLKO.1 2515 CDS 100% 5.625 3.938 N RAPGEF3 n/a
6 TRCN0000047231 CGGCTGGAAGAACATGGCAAA pLKO.1 1157 5UTR 100% 4.050 2.835 N RAPGEF3 n/a
7 TRCN0000047229 CCAGAGAAGATCCTAGAGCTT pLKO.1 1271 5UTR 100% 2.640 1.848 N RAPGEF3 n/a
8 TRCN0000047232 CAACTCGGTGAAGCGAGAATT pLKO.1 844 5UTR 100% 0.000 0.000 N RAPGEF3 n/a
9 TRCN0000281825 TCTGGAAGGGATCTGTCAATG pLKO_005 951 5UTR 100% 10.800 7.560 N Rapgef3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.