Transcript: Human XM_005269007.3

PREDICTED: Homo sapiens kinesin family member 21A (KIF21A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF21A (55605)
Length:
6401
CDS:
178..5205

Additional Resources:

NCBI RefSeq record:
XM_005269007.3
NBCI Gene record:
KIF21A (55605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269007.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083407 CCCAATTCTTAGAGCTCTATA pLKO.1 614 CDS 100% 13.200 18.480 N KIF21A n/a
2 TRCN0000425701 GCTAATGATGCTGCAACATAA pLKO_005 2220 CDS 100% 13.200 18.480 N KIF21A n/a
3 TRCN0000426725 TTGATACCACTCGTGATATTG pLKO_005 656 CDS 100% 13.200 18.480 N KIF21A n/a
4 TRCN0000083405 GCCAACATAATGCAGATGGAA pLKO.1 3199 CDS 100% 3.000 4.200 N KIF21A n/a
5 TRCN0000083406 GCGTGTAAGAATTAAAGCCAT pLKO.1 1482 CDS 100% 2.640 3.696 N KIF21A n/a
6 TRCN0000083404 CCCGTAATGAACTGAATGTTT pLKO.1 4016 CDS 100% 5.625 4.500 N KIF21A n/a
7 TRCN0000112898 CCCAGAAAGAGGCTCAAATTA pLKO.1 3344 CDS 100% 15.000 10.500 N Kif21a n/a
8 TRCN0000432371 ACAGCAAGAGCGCCATATTTC pLKO_005 1708 CDS 100% 13.200 9.240 N KIF21A n/a
9 TRCN0000112899 GCCCAGAAAGAGGCTCAAATT pLKO.1 3343 CDS 100% 13.200 7.920 N Kif21a n/a
10 TRCN0000315486 GCCCAGAAAGAGGCTCAAATT pLKO_005 3343 CDS 100% 13.200 7.920 N Kif21a n/a
11 TRCN0000083403 GCTGTGATAATACTCTGTATT pLKO.1 5236 3UTR 100% 13.200 7.920 N KIF21A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269007.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.