Transcript: Human XM_005269089.2

PREDICTED: Homo sapiens IKAROS family zinc finger 4 (IKZF4), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IKZF4 (64375)
Length:
5095
CDS:
375..1991

Additional Resources:

NCBI RefSeq record:
XM_005269089.2
NBCI Gene record:
IKZF4 (64375)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016195 ACAGCGTGATTGTGGAAGATT pLKO.1 604 CDS 100% 5.625 4.500 N IKZF4 n/a
2 TRCN0000274866 ACAGCGTGATTGTGGAAGATT pLKO_005 604 CDS 100% 5.625 4.500 N IKZF4 n/a
3 TRCN0000274797 CCTTAGCTCTGTGGCATTATA pLKO_005 2491 3UTR 100% 15.000 10.500 N IKZF4 n/a
4 TRCN0000016196 GAGTGCAACATCTGTGGTTAT pLKO.1 1908 CDS 100% 10.800 7.560 N IKZF4 n/a
5 TRCN0000016194 CCCACCAATTGCATCTCAGAA pLKO.1 1395 CDS 100% 4.950 3.465 N IKZF4 n/a
6 TRCN0000016197 GCCTGTCATCAGCTCTGTCTA pLKO.1 1421 CDS 100% 4.950 3.465 N IKZF4 n/a
7 TRCN0000274799 GCCTGTCATCAGCTCTGTCTA pLKO_005 1421 CDS 100% 4.950 3.465 N IKZF4 n/a
8 TRCN0000016193 CCCAGAAGTTTGTAGGCGAAA pLKO.1 1216 CDS 100% 4.050 2.835 N IKZF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.