Transcript: Human XM_005269630.4

PREDICTED: Homo sapiens cytoplasmic polyadenylation element binding protein 3 (CPEB3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPEB3 (22849)
Length:
7779
CDS:
205..2259

Additional Resources:

NCBI RefSeq record:
XM_005269630.4
NBCI Gene record:
CPEB3 (22849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269630.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240701 ACGCTTTCCGGACCGATAATG pLKO_005 1166 CDS 100% 13.200 18.480 N CPEB3 n/a
2 TRCN0000179226 GACATTGACAAACGGGTTGAA pLKO.1 2017 CDS 100% 4.950 6.930 N CPEB3 n/a
3 TRCN0000240697 CATAACAGAATGACCTATATT pLKO_005 3327 3UTR 100% 15.000 10.500 N CPEB3 n/a
4 TRCN0000240699 ACTCCTTAATGGATATGATAA pLKO_005 1256 CDS 100% 13.200 9.240 N CPEB3 n/a
5 TRCN0000240698 CTGCTATGCTGGCATTGATAC pLKO_005 1890 CDS 100% 10.800 7.560 N CPEB3 n/a
6 TRCN0000146947 CAAAGCTGAAAGCAAGTCTTA pLKO.1 1581 CDS 100% 4.950 3.465 N CPEB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269630.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.