Transcript: Human XM_005271175.3

PREDICTED: Homo sapiens LDL receptor related protein 8 (LRP8), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRP8 (7804)
Length:
4120
CDS:
143..2647

Additional Resources:

NCBI RefSeq record:
XM_005271175.3
NBCI Gene record:
LRP8 (7804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055500 CGAGTGGCATTAAGCCTTGAA pLKO.1 2609 CDS 100% 4.950 3.960 N LRP8 n/a
2 TRCN0000055501 CCTTGCAATCAAGCACTGCAA pLKO.1 691 CDS 100% 0.264 0.211 N LRP8 n/a
3 TRCN0000300116 CCTTGCAATCAAGCACTGCAA pLKO_005 691 CDS 100% 0.264 0.211 N LRP8 n/a
4 TRCN0000055499 GACCTCAAGATTGGCTTTGAA pLKO.1 812 CDS 100% 5.625 3.938 N LRP8 n/a
5 TRCN0000300174 GACCTCAAGATTGGCTTTGAA pLKO_005 812 CDS 100% 5.625 3.938 N LRP8 n/a
6 TRCN0000055502 CTCAAGAATGTCGTGGCACTA pLKO.1 1100 CDS 100% 4.050 2.835 N LRP8 n/a
7 TRCN0000300173 CTCAAGAATGTCGTGGCACTA pLKO_005 1100 CDS 100% 4.050 2.835 N LRP8 n/a
8 TRCN0000055498 CACCTCAATCTACCTCAACTA pLKO.1 1965 CDS 100% 4.950 2.970 N LRP8 n/a
9 TRCN0000300117 CACCTCAATCTACCTCAACTA pLKO_005 1965 CDS 100% 4.950 2.970 N LRP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.