Transcript: Human XM_005271315.3

PREDICTED: Homo sapiens zinc finger protein 697 (ZNF697), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF697 (90874)
Length:
5061
CDS:
141..1778

Additional Resources:

NCBI RefSeq record:
XM_005271315.3
NBCI Gene record:
ZNF697 (90874)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230547 TGTAGCTGACATGGCGATGTT pLKO_005 428 CDS 100% 4.950 6.930 N ZNF697 n/a
2 TRCN0000218459 CTGCATTAAGTGAGGTTAAAT pLKO_005 4427 3UTR 100% 15.000 10.500 N ZNF697 n/a
3 TRCN0000230545 GAAAGAGAAATGGGCTCTAAT pLKO_005 246 CDS 100% 13.200 9.240 N ZNF697 n/a
4 TRCN0000230548 TGTCTGAGTCTGACAGCATAT pLKO_005 457 CDS 100% 10.800 7.560 N ZNF697 n/a
5 TRCN0000230546 GTGAGGAAGAAGGCGTTTCTG pLKO_005 379 CDS 100% 4.950 3.465 N ZNF697 n/a
6 TRCN0000422075 GAAGCGCTTCAGCGACTTCTC pLKO_005 1553 CDS 100% 1.350 0.945 N Zfp697 n/a
7 TRCN0000107779 GCGCATCCACACGGGCGAGAA pLKO.1 1256 CDS 100% 0.000 0.000 Y ZNF787 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.