Transcript: Human XM_005272237.3

PREDICTED: Homo sapiens ADAMTS like 2 (ADAMTSL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTSL2 (9719)
Length:
3923
CDS:
86..3268

Additional Resources:

NCBI RefSeq record:
XM_005272237.3
NBCI Gene record:
ADAMTSL2 (9719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118525 GCCCGAGACATCCAGATTGTA pLKO.1 1127 CDS 100% 5.625 7.875 N ADAMTSL2 n/a
2 TRCN0000438962 GACGAAGCTGGCTACTACTTC pLKO_005 1184 CDS 100% 4.950 6.930 N ADAMTSL2 n/a
3 TRCN0000439446 GGAATGCCCACCTTGGTTACT pLKO_005 1080 CDS 100% 4.950 6.930 N ADAMTSL2 n/a
4 TRCN0000118526 CATCCAGATTGTAGAGAGGAA pLKO.1 1135 CDS 100% 2.640 3.696 N ADAMTSL2 n/a
5 TRCN0000118523 GAGAGCTTCTTCGTGGATTAT pLKO.1 1889 CDS 100% 13.200 9.240 N ADAMTSL2 n/a
6 TRCN0000441484 ATCTCCAGCAAACCGTGTGAC pLKO_005 839 CDS 100% 4.050 2.835 N ADAMTSL2 n/a
7 TRCN0000118524 CCTGAATGTCATGGTGTGGAA pLKO.1 1339 CDS 100% 2.640 1.848 N ADAMTSL2 n/a
8 TRCN0000118522 GCCTTCTGAAGGAAACTTGCA pLKO.1 3652 3UTR 100% 2.640 1.848 N ADAMTSL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.