Transcript: Human XM_005273023.5

PREDICTED: Homo sapiens serologically defined colon cancer antigen 8 (SDCCAG8), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SDCCAG8 (10806)
Length:
1660
CDS:
107..1189

Additional Resources:

NCBI RefSeq record:
XM_005273023.5
NBCI Gene record:
SDCCAG8 (10806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273023.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435650 ACGACCTTGTTCATACTATTA pLKO_005 453 CDS 100% 13.200 18.480 N SDCCAG8 n/a
2 TRCN0000128868 GAGGAACGACTTAGCTGAATA pLKO.1 844 CDS 100% 13.200 18.480 N SDCCAG8 n/a
3 TRCN0000421956 CTTTCCCAAACCCATACTAAT pLKO_005 983 CDS 100% 13.200 9.240 N SDCCAG8 n/a
4 TRCN0000130059 GCTGTTAATCAGCTCAAAGAT pLKO.1 323 CDS 100% 5.625 3.938 N SDCCAG8 n/a
5 TRCN0000127833 GCAGAAGCATTCACCAACTGA pLKO.1 183 CDS 100% 3.000 2.100 N SDCCAG8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273023.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.