Transcript: Human XM_005273195.4

PREDICTED: Homo sapiens prospero homeobox 1 (PROX1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PROX1 (5629)
Length:
8279
CDS:
644..2860

Additional Resources:

NCBI RefSeq record:
XM_005273195.4
NBCI Gene record:
PROX1 (5629)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273195.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016251 CCGACGTAAAGTTCAACAGAT pLKO.1 2466 CDS 100% 4.950 6.930 N PROX1 n/a
2 TRCN0000016252 CCAGTTTGATATGGATCGCTT pLKO.1 1093 CDS 100% 2.640 3.696 N PROX1 n/a
3 TRCN0000232126 CCCTTTGGATGTCCAAGTTAT pLKO_005 2903 3UTR 100% 13.200 10.560 N PROX1 n/a
4 TRCN0000232122 TTTCCAGGAGCAACCATAATT pLKO_005 902 CDS 100% 15.000 10.500 N PROX1 n/a
5 TRCN0000232123 AGTACATCAGGAGGATATATG pLKO_005 1009 CDS 100% 13.200 9.240 N PROX1 n/a
6 TRCN0000232125 GAAGTTGCTCAGATCACATTA pLKO_005 2693 CDS 100% 13.200 9.240 N PROX1 n/a
7 TRCN0000232124 GGCTCTCCTTGTCGCTCATAA pLKO_005 2289 CDS 100% 13.200 9.240 N PROX1 n/a
8 TRCN0000016250 GCTCTGAACATGCACTACAAT pLKO.1 2633 CDS 100% 5.625 3.938 N PROX1 n/a
9 TRCN0000016249 CCCGAGAAAGTTACAGAGAAA pLKO.1 1242 CDS 100% 4.950 3.465 N PROX1 n/a
10 TRCN0000016248 CCCTTAACATTTGGACACTTA pLKO.1 3087 3UTR 100% 4.950 3.465 N PROX1 n/a
11 TRCN0000070724 CCGAAGTACATCAGGAGGATA pLKO.1 1005 CDS 100% 4.950 3.465 N Prox1 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6838 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273195.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.