Transcript: Human XM_005274222.1

PREDICTED: Homo sapiens myelin regulatory factor (MYRF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYRF (745)
Length:
5930
CDS:
97..3555

Additional Resources:

NCBI RefSeq record:
XM_005274222.1
NBCI Gene record:
MYRF (745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005274222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263524 ACACCGGAGACATGGTCTTTG pLKO_005 2048 CDS 100% 10.800 15.120 N MYRF n/a
2 TRCN0000173092 CCTCGACTGCTTCTATCTGAA pLKO.1 1371 CDS 100% 4.950 3.960 N MYRF n/a
3 TRCN0000263523 GGCCCTGAACCAGTCCATTAA pLKO_005 1413 CDS 100% 13.200 9.240 N MYRF n/a
4 TRCN0000263527 TCATGGAAGGAGTGTAGTATT pLKO_005 4795 3UTR 100% 13.200 9.240 N MYRF n/a
5 TRCN0000263526 CAAGGTCATGGGCTCGCTTAT pLKO_005 1827 CDS 100% 10.800 7.560 N MYRF n/a
6 TRCN0000263525 TGCTGAATGGAATGATCAAAC pLKO_005 905 CDS 100% 10.800 7.560 N MYRF n/a
7 TRCN0000172945 GCTGGTGCACTACAGATACAA pLKO.1 1929 CDS 100% 5.625 3.375 N MYRF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005274222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.