Transcript: Human XM_005274432.1

PREDICTED: Homo sapiens interleukin 3 receptor subunit alpha (IL3RA), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL3RA (3563)
Length:
1537
CDS:
180..1313

Additional Resources:

NCBI RefSeq record:
XM_005274432.1
NBCI Gene record:
IL3RA (3563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005274432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058398 CCCGGGAAAGAGTGTATGAAT pLKO.1 997 CDS 100% 5.625 7.875 N IL3RA n/a
2 TRCN0000058399 CGTCAACAGTACGAGTGTCTT pLKO.1 612 CDS 100% 4.950 6.930 N IL3RA n/a
3 TRCN0000425997 GAAGTCATTTCAATCGCAAAT pLKO_005 862 CDS 100% 10.800 8.640 N IL3RA n/a
4 TRCN0000433350 ATGACTGCAAAGTGTAATAAG pLKO_005 813 CDS 100% 13.200 9.240 N IL3RA n/a
5 TRCN0000431391 ACTCTCCAGCGGTTCTCAAAG pLKO_005 692 CDS 100% 10.800 7.560 N IL3RA n/a
6 TRCN0000426587 ACACGTATCGGGTGTCGTTTC pLKO_005 657 CDS 100% 6.000 4.200 N IL3RA n/a
7 TRCN0000058400 GCTATGAGCTTCAGATACAAA pLKO.1 886 CDS 100% 5.625 3.938 N IL3RA n/a
8 TRCN0000058402 CCTGGAACGTACACAGTACAA pLKO.1 969 CDS 100% 4.950 3.465 N IL3RA n/a
9 TRCN0000058401 GCAAACGAAGGAAGATCCAAA pLKO.1 230 CDS 100% 4.950 3.465 N IL3RA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005274432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.