Transcript: Human XM_005277436.3

PREDICTED: Homo sapiens integrin subunit alpha 10 (ITGA10), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGA10 (8515)
Length:
5020
CDS:
113..3430

Additional Resources:

NCBI RefSeq record:
XM_005277436.3
NBCI Gene record:
ITGA10 (8515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005277436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057727 CAACACACAAACAGACTGAAT pLKO.1 3023 CDS 100% 4.950 6.930 N ITGA10 n/a
2 TRCN0000057724 CGAGAAACAAAGACTGCCCAA pLKO.1 647 CDS 100% 2.160 3.024 N ITGA10 n/a
3 TRCN0000057725 CGCTATGAGGTTCACCCATAT pLKO.1 2777 CDS 100% 10.800 8.640 N ITGA10 n/a
4 TRCN0000442892 GAACATCACCCACGCCTATTC pLKO_005 115 CDS 100% 10.800 7.560 N ITGA10 n/a
5 TRCN0000428393 TTGGAAAGGATGAGGGTTATC pLKO_005 3797 3UTR 100% 10.800 7.560 N ITGA10 n/a
6 TRCN0000057723 CCTGAGAGAAATTAGAACTAT pLKO.1 880 CDS 100% 5.625 3.938 N ITGA10 n/a
7 TRCN0000057726 CGGCTAAAGGATGGGATTCTT pLKO.1 1067 CDS 100% 5.625 3.938 N ITGA10 n/a
8 TRCN0000065805 CCTGCTGTGAATATGCACCTA pLKO.1 230 CDS 100% 2.640 1.848 N LOC280413 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005277436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.