Transcript: Mouse XM_006495501.3

PREDICTED: Mus musculus suppression of tumorigenicity 18 (St18), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St18 (240690)
Length:
6974
CDS:
1501..4638

Additional Resources:

NCBI RefSeq record:
XM_006495501.3
NBCI Gene record:
St18 (240690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042481 CGAATCCACGACAAGTCTATA pLKO.1 3358 CDS 100% 13.200 18.480 N St18 n/a
2 TRCN0000427973 GAAACGTCCTCTCCTACAAAC pLKO_005 3033 CDS 100% 10.800 15.120 N St18 n/a
3 TRCN0000042479 GCAGCAGTATCCAGTCTTTAA pLKO.1 1952 CDS 100% 13.200 10.560 N St18 n/a
4 TRCN0000042482 GCCTATCAATGAGCAGAATTT pLKO.1 4500 CDS 100% 13.200 10.560 N St18 n/a
5 TRCN0000421152 CTGAATGAATCCAACCTTAAA pLKO_005 4300 CDS 100% 13.200 9.240 N St18 n/a
6 TRCN0000416536 GCAGGCACACAGGGTGAATTT pLKO_005 2883 CDS 100% 13.200 9.240 N St18 n/a
7 TRCN0000436411 TATAAGGAGCTGGACCGATTT pLKO_005 2464 CDS 100% 10.800 7.560 N St18 n/a
8 TRCN0000042478 CGCAACACTCACAGAAGTCTT pLKO.1 2773 CDS 100% 4.950 3.465 N St18 n/a
9 TRCN0000042480 CTGAACTTAGATGCCCTGTAA pLKO.1 3929 CDS 100% 4.950 2.970 N St18 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5858 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000414714 CATCTATGGAGAGCAACTTAA pLKO_005 4358 CDS 100% 13.200 9.240 N ST18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.